Find your name and copy your sequence

> 156853_ Talaya

CATTATTGAATGAAACTTCTGGCTGGATGCTGTTGTGCTGGCCCTTTGGTGCAATGTGCACACACTTCTGGTTGT CTGTTTCTTCTGTTCCACCTGTGCACTGCCTGTAGACACTCTGTGTCTATGATATTGGTTACANCACACATGATG TTTTGCATATTGGTNTACATATGTATGATAATATACAACTTTCAACANACGGATCTCTTGGCTCNTCGCATCGAT GAAGAACACAGCGAAATGTGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCATCTT GCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAACTATCAAAGCACCTTTCCTGGGGTGTTT TGGACTTTGGGAGTATTTTGCTGGCCTGTTTGAGCCAGCTCTCCTCAAAAGCATTAGCTTTGGAGACCATCAGTG TGATAACTCTCTTTACACTGACTGAGTGTGTCTCTGCTTCTTAAATATGCTGGACACCCTTTGACCT

 

> 150915 _ Tina

CATTACTGAAATGAACCTTGAGGCTGTCGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCA CCTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCAGTCTCTTGAGAGAATTGAAATCCTGGGTGTC TATGCCATTTTATTACACACTAGTTGCATGTTTATAGAATGATGATTTGATTAAATATAAAATACAACTTTCAAC AACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT GAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAACA TCTCAAGACCTGTCTGTTTTTGATAGGTATTGGATTTTTGGGGGTTGCAGGCTGTTTCAGATAGCTTGCTCTCCT TGAATGTATTAGTGGAGAAAGAGCCATTGAACTCCATTGGTGTGATAAAATCTATCAATGCCAGGAGCCATGTTA GTTCTCTCTGCTGTCTAACCCCTAACAGTTGTCTGTAAAAAATGGACAACTTGACCAACTTGACCT

 

 

 

> 52573_ Alexandra

CATTATTGAATGAAGCCTCTGGCAAGGGGGTTGTAGCTGACTCCTCTAGGGGGGTATGTGCACACCTGTCTGTCA CTTGTTTCTTCATTTTCTCCACATGTGCACTTTTTGTAGGCAGCCTTGGCAATTAACGTTCAGGTTGTCTATGTT TTTTTACATACACATATTCTATATGAATGTTGTAATGAGTGTTATAAAAATAATAATACAACTTTCAACAACGGA TCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA TCGAATCTTTGAACGCMCCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATCCTCAA AACCATTGTGTTTTGGATTATGGGAGTGTCTGCTGGCTTACTCCAAGTCAGCTCTCCTGAAAAACATTAGCTTGG GGGGATGTGCCAAGTCAACTTTGCCTCTCATTGGTGTGATAGATATTATCTACGCCAGGAAGTGAAGCACTTCGG ATCCTTCTGCTCGCTAATCAAATTCAGTAACCAACTTGACCT

 

> 52519_ Genevieve

CATTATCGAATCCTACCAGGGAGGGAGGGAAAACGGACAAGGACTCTCAAGGCTGTCGCCGGCAACGTGCACGCC TTCCTCTTTCATGGACCCCCCTTTCTAGTTTCCTTATTCACCTGTGCACCCTTTGTAGGCCCTCGAAAGAGGTTC TATGTTTATCTATCTACTATCACATGTATGTCCAGAATGTATACAAATTTTACAACTTTCAGCAACGGATCTCTT GGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAA TCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATG TCTTGAATGAGGCATGGCTTGGACTTGGGGGTTGCTGGCACACGTCTGTCAGCTCTCCTGAAATGCATTAGCGAT GGTCAGCAAGCCTGACGTGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGGTAGGGTGAGCGG TGAATCGCTTCTAATCTAAAGTCGGTCGTGAGACTGACTGAGGCTAGCCTTAGTTACTAGTCGGTCGTGAGGCTG ACGAACGCAGGCAGGGTCTAGGTTTGAACTCTTGACCT

 

> 150966 _ Jennifer

CATTATTGAACTCTTTTGGTTGGAGGGGGCTTTCAGTTGCTGGCTTTAAAGGCAATGTGCACGAAACTCTCAACA CCAGATTTGATCTGATTTGTGGTTGTCGCAGATTCTTCTGTTGCAATCATGAGTTGGTTTTCTTCATCCACCTGT GCACTTTCTGTAGAAGTTTTGTTAGGTTGATCCTTAACAAGACTTTTATGTCTTTATAAAAACCCCATGTATGTT AAGAATGTCTTTTTATTGGGGCTAAATTTTGACCCATTAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCT CTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATTTTT GAACGCACCTTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACTTTATCAGG TTTTTATTAACTTGTTGAAGCTTGGATGTGGAGGTTTTGCTGGCATTTCAAATGTCTGGCTCCTCTTAAATGCAT TAGTGGGTTTCCGTTTGTTTGAAAACCACCTTGGTGTGATAATTATCTACGCTTTGGTTGATTCAACTCTCAGAT AGTCTTTGTAAATTAAGACTGTTTTGGTTAGGATACTGCATTGATTTGCTTTATCTGAAGGAAAGCCTGCTCCTA CTGTCTGTGTATATGGACATTTATTGACTATTGACTCAATCAGTAGATACCGCTGACTTA

 

> 52349_ Yen

CATTAACGAATAACTATGGTGTCTTGGCTGTCGCTGGCTCCTCGGAGCATCGTGCACGCCCGCCATTTTTATCTA TCCACCTGTGCACCGAATGTAGGTCTGGATGACTATCGTCTCTGGGCGGATGCGAGGTTTGCGTGTGCGTTGCGT ACGGGCTCACCTCGAATTTCCAGACTCTACGTCTTTTTACACACCCCAAACGTATGATGCAGAATGTAGTCAATG GGCCTTTAAAAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTT GGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTTTTGAACGGTTCTCCGA GGCTTGGGATGTGGGGGTTTGTGCAGGCTGCCTCAGTGCGGTCTGCTCCCCTGAAATGTATTAGCGAGATTCATA TCTGAACCTCCGTCTATCGGTGTGATAATTAGCTACGTCGTTGACTTGGTTCGGACTCGCTTCTAACCGTCCGCG AGGACAAACATACTTGACAATTGACCT

 

> 156007_ Sahar

ATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTTGGGAGCATGTGCACGCCTTGTCATCTTTATATCT CCACCTGTGCACCTTTTGTAGACCTTTCAGGTCTATGTTGCTTCATTTACCCCAATGTATGTTAATAGAATGTTG TGCCTTATATAATAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATG CGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCG AGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCCTTCACTTGTTGAGCGGTTTGGATGTGGGGGTTTGCC TGGCCTCTTAAAAGGTTTTGGCTCCCCTGAAATGCATTAGCAGAACAACCCTGTTCATTGGTGTGATAAACTATC TACGCTATTGAATGTGAAGGGCAGTTTGGCTTTCTAACAGTCCTCGGACAAACTCATCATTAATG

 

> 156035_ Ka

CATTATTGAATAAACCTGATGGGTTGTAGCTGGTTCCTCCTGGGACAAGTGCTCGCCTGTCATCTTTATATCTCC ACCTGTGCACTTTTTGTAGACCTGGATAACTTTCTGAGGCAACTCAGTTCGGAGGACTGCTGTGTGTTTTNCTAC GCCGGCTTTCCTTACATTTCCAGGCCTANGTTTTTCATATACCCCATTGTATGTAACAGAATGTTTCACAAGGCT TCAATGCCTATAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAA TGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTC CGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTATCAGCTTTTCACAAAGCTTGGTAAGGCTTGGAT GTGGAGGTTTGCAGGCTTCTTACAAAGTCAGCTCCTCTGAAATGCATTAGCGGTACCCGTGTGGAATCGTCTATT GGTGTGATAATATCTACGCCGTGGACATCTGCTTTAAATGGGTTATGCTGCTTATAACCGTCCCACTGTGGACAA CTTATGACAATTTGACCT

 

> 157005_ Guleid

CATTATTGAAATAAACCTGCTGGGTTGTTGCTGGCTCTCTAGGGAGCATGTGCACGCCTTGTCATCTTTATATCT CCACCTGTGCACCTTTTGTAGACATCTTTCCCAGGTGTCTATGTTGACCCTTCATTTGCCCCCAATGTATGTCAA TAGAATGTTGTGTCCATGATAATAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGC TCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATTATATATCGAACCCTCTTTTGTTGAGTGGT TTGGATGTGGGGTTTGCTGGCCTCTTGAAGAGGTCAGCTTCCCTGAAATGCATTAGCAGAACAACCTGTTCGTTC ATTGGTGTGATAACTATCTACGCTATTGAATGGTGAAGGCAATTTCAGCTTCCTAACCGTCTTTGGACAATTTAT CAATCTATATGTGACCT

 

> 156005 _ Anthony

CATTATTGAAATAACCTGATGGGTTGTTGCTGGTTCTCTTGGGAGCATGTGCACGCCTTGTCATCTTTATATCTC CACCTGTGCACCTTTTGTAGACCTTTCAGGTCTATGTTGCTTCATTTACCCCAATGTATGTTAATAGAATGTTGT GCCTTATATAATAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGC GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGA GGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCCTTCACTTGTTGAGCGGTTTGGATGTGGGGGTTTGCCT GGCCTCTTAAAAGGTTTTGGCTCCCCTGAAATGCATTAGCAGAACAACCCTGTTCATTGGTGTGATAAACTATCT ACGCTATTGAATGTGAAGGGCAGTTTGGCTTTCTAACAGTCCTCGGACAAACTCATCATTAATGTGACCT

 

> 156907 _ Maciej

CATTATTGAAATAAACCTGATGAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCGTCTTTATATTTC CACCTTGTGCACCTTTTGTAGACCTGGATATCTCTCTGAATGCACACAAGCATTTGGGTTTGAGGGGTTGACTTT TTTGGTCTCCCTTTATATTTCCAGGCCTATGTTTCTTTCATATACCCCACTTGTGTTATAGAATGTAATAAATGG GCCTTTGTGCCTGTAAAGCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGA AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT TCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAACTTGTGTTGAGTGTTGGATGTGGGGG TTCTTTCTTTGCTGGCTTCACGGTCAGCTCCCCTGAAATGCATTAGCGGAACAACCTGTTCACTGTTCATTGGCG TGATAACTATCTACGCTGCTTGTTGACAGTGAAGCAAGTTCAGCTTCTAACAGTCCATTAAATTGGACAAATTTTTATTAATGTGACCT

 

> 157049 _ Ronald

CATTATTGAATGAACTTGGTGTGGTTGTTGCTGGCTCTTTCGAGGGCATGTGCACGCCCACCATCCTCATCTCTC CACCTGTGCACCTCTTGTAGACTTGGATTGACTTTCCGAGGCAACTCGGTCGGGAGGATTGCCGGCGCCAGCTGG CTTTCTTTGCATTTCCAGGTCTACGTTTTTCATATACCCCATTGTATGTAACAGAATGTAACATTGGGCACTTGT GCCTATAAACTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGA TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGG AGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTATCAACTTTTGTTGATAATGGCTTGGATATGGGGGTT TATTTTGCTGGCTTCTTTACAGATGGTCAGCTCCCCTTAAATGCATTAGCCGGTGCCCCGCGTGGACTGTCTATT GGTGTGATAATTATCTACGCCGTGGACATCTGCAATCATATGGGTTTGCACTGCTTCCAACTGTCTGTTGAATCA GACAATACATGACAATTTGACCT

 

> 156019_ Hae

CATTAACGAATTTCTCAAAGTTGCTTACAGCGTTGTGCGGTCATTCGCATATGTTGAAGGTAGCTCTTGAGCATT TCACACATCCCCTGTGCACCTTAAGAGGGTAACTGTTTTATCTTGAGCGCGTTGTGCTCGATAGGACGTGTTGCC CTCTCTTTACAAAATCTTATGTCTAGAATGTCTGATAAAATTAAACAAAATAACTTTCAACAACGGATCTCTTGG CTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGATAATCTCAAATCAACAT TTTAGTTAATCTAATTTGTTGACTTGGACTTGGAGGTTGTGCTGATTTTATTATTGGCTCCTCTTAAATGCATTA GCTGGATTACTATCAGTAATAGTCCATGGTGTTGTAATCTCGGCGCTGTGACTTAACTAATACAATCTGCTTCTA AAATAGTTGCCTTTGGCAATATTTGCAAACTTGACCT

 

 

> 156874 _ Janson

CATTATCGTACAAAATGTGTGAWGGCGCGTGAGGGCTGTCGCTGACTTTTTAACACAAAAGTCGTGCACCGGA GCGCGTCCTCTCGCATAAAATCCATCTCACCCTTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCGAACCGAT CCAGGAGGGTGCTTGCGTTTTCACACAAACCCCCTTTAAAAAGTGTAGAATGTCCCCATTTTGCGATGACACGCA ATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATG TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCC GTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTCTCCTTCTGGACACCGAAGGAGGCTTGGACTCTGGAGGCCT TTGCTGGCGTCTCTCTCTTTTTGAGAGCCAGCTCCTCTTAAACGAATTAGCGGGGTCCTCTTTGCCGATCCTCGA CATGTGATAAGATGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCCTTTGGGACCCGCTTCTAACCGTCTCAACGA GACGACGTTTGGGCGTGTCTCCCTTCTCGGGAAACTCTCTCAACCCCACGAACCCTTGACCT

 

> 155844_ So

CATTATTGAATAACTTGGTGTTGAGCTGGCCCTATTGGGCATGTGCTCGCATCATATTATTTATCTATCTCTTGT GCACCTTTTGTAGTCTTTGGAGCACTCGCAGTCAATGCGGTTTTGGGGCTTGGGCTTTGCTGCCCTTTTCCCTGT TTGCTTCAAAGGCTATGTTTTATACACACTATTGAAGTTACAGAATGTCTCTTATTGACTTTGAGTCAGTAAATC TATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTT TGAGTGTCATTAAATTCTCAACCTTGCAAGCTTGCTTGCGAGGCTTGGATGTGAGGGTTTTTGCTGGCTTCCTTT AGTTGGATGGTCTGCTCCCTTTAAATTCATTAGTGGGATCCTTTGTGGATGGTCACTTGGTGTGATAATTATCTA CGCCGTCTGATCCTGAAACAAGACTTGTGGGGACCTGCTTATAACCGTCTCTTTGGAGACAATCTTGACAATTTGACCT

 

 

> 156853_ Ran

CATTATTGAATGAAACTTCTGGCTGGATGCTGTTGTGCTGGCCCTTTGGTGCAATGTGCACACACTTCTGGTTGT CTGTTTCTTCTGTTCCACCTGTGCACTGCCTGTAGACACTCTGTGTCTATGATATTGGTTACANCACACATGATG TTTTGCATATTGGTNTACATATGTATGATAATATACAACTTTCAACANACGGATCTCTTGGCTCNTCGCATCGAT GAAGAACACAGCGAAATGTGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCATCTT GCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAACTATCAAAGCACCTTTCCTGGGGTGTTT TGGACTTTGGGAGTATTTTGCTGGCCTGTTTGAGCCAGCTCTCCTCAAAAGCATTAGCTTTGGAGACCATCAGTG TGATAACTCTCTTTACACTGACTGAGTGTGTCTCTGCTTCTTAAATATGCTGGACACCCTTTGACCT

 

> 150915 _ Vivian

CATTACTGAAATGAACCTTGAGGCTGTCGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCA CCTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCAGTCTCTTGAGAGAATTGAAATCCTGGGTGTC TATGCCATTTTATTACACACTAGTTGCATGTTTATAGAATGATGATTTGATTAAATATAAAATACAACTTTCAAC AACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT GAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAACA TCTCAAGACCTGTCTGTTTTTGATAGGTATTGGATTTTTGGGGGTTGCAGGCTGTTTCAGATAGCTTGCTCTCCT TGAATGTATTAGTGGAGAAAGAGCCATTGAACTCCATTGGTGTGATAAAATCTATCAATGCCAGGAGCCATGTTA GTTCTCTCTGCTGTCTAACCCCTAACAGTTGTCTGTAAAAAATGGACAACTTGACCAACTTGACCT

 

 

 

> 52573_ Ali

CATTATTGAATGAAGCCTCTGGCAAGGGGGTTGTAGCTGACTCCTCTAGGGGGGTATGTGCACACCTGTCTGTCA CTTGTTTCTTCATTTTCTCCACATGTGCACTTTTTGTAGGCAGCCTTGGCAATTAACGTTCAGGTTGTCTATGTT TTTTTACATACACATATTCTATATGAATGTTGTAATGAGTGTTATAAAAATAATAATACAACTTTCAACAACGGA TCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA TCGAATCTTTGAACGCMCCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATCCTCAA AACCATTGTGTTTTGGATTATGGGAGTGTCTGCTGGCTTACTCCAAGTCAGCTCTCCTGAAAAACATTAGCTTGG GGGGATGTGCCAAGTCAACTTTGCCTCTCATTGGTGTGATAGATATTATCTACGCCAGGAAGTGAAGCACTTCGG ATCCTTCTGCTCGCTAATCAAATTCAGTAACCAACTTGACCT

 

> 52519_ Sepideh

CATTATCGAATCCTACCAGGGAGGGAGGGAAAACGGACAAGGACTCTCAAGGCTGTCGCCGGCAACGTGCACGCC TTCCTCTTTCATGGACCCCCCTTTCTAGTTTCCTTATTCACCTGTGCACCCTTTGTAGGCCCTCGAAAGAGGTTC TATGTTTATCTATCTACTATCACATGTATGTCCAGAATGTATACAAATTTTACAACTTTCAGCAACGGATCTCTT GGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAA TCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATG TCTTGAATGAGGCATGGCTTGGACTTGGGGGTTGCTGGCACACGTCTGTCAGCTCTCCTGAAATGCATTAGCGAT GGTCAGCAAGCCTGACGTGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGGTAGGGTGAGCGG TGAATCGCTTCTAATCTAAAGTCGGTCGTGAGACTGACTGAGGCTAGCCTTAGTTACTAGTCGGTCGTGAGGCTG ACGAACGCAGGCAGGGTCTAGGTTTGAACTCTTGACCT

 

> 150966_ Stephanie  

CATTATTGAACTCTTTTGGTTGGAGGGGGCTTTCAGTTGCTGGCTTTAAAGGCAATGTGCACGAAACTCTCAACA CCAGATTTGATCTGATTTGTGGTTGTCGCAGATTCTTCTGTTGCAATCATGAGTTGGTTTTCTTCATCCACCTGT GCACTTTCTGTAGAAGTTTTGTTAGGTTGATCCTTAACAAGACTTTTATGTCTTTATAAAAACCCCATGTATGTT AAGAATGTCTTTTTATTGGGGCTAAATTTTGACCCATTAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCT CTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATTTTT GAACGCACCTTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACTTTATCAGG TTTTTATTAACTTGTTGAAGCTTGGATGTGGAGGTTTTGCTGGCATTTCAAATGTCTGGCTCCTCTTAAATGCAT TAGTGGGTTTCCGTTTGTTTGAAAACCACCTTGGTGTGATAATTATCTACGCTTTGGTTGATTCAACTCTCAGAT AGTCTTTGTAAATTAAGACTGTTTTGGTTAGGATACTGCATTGATTTGCTTTATCTGAAGGAAAGCCTGCTCCTA CTGTCTGTGTATATGGACATTTATTGACTATTGACTCAATCAGTAGATACCGCTGACTTA

 

> 52349_ Gianne  

CATTAACGAATAACTATGGTGTCTTGGCTGTCGCTGGCTCCTCGGAGCATCGTGCACGCCCGCCATTTTTATCTA TCCACCTGTGCACCGAATGTAGGTCTGGATGACTATCGTCTCTGGGCGGATGCGAGGTTTGCGTGTGCGTTGCGT ACGGGCTCACCTCGAATTTCCAGACTCTACGTCTTTTTACACACCCCAAACGTATGATGCAGAATGTAGTCAATG GGCCTTTAAAAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTT GGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTTTTGAACGGTTCTCCGA GGCTTGGGATGTGGGGGTTTGTGCAGGCTGCCTCAGTGCGGTCTGCTCCCCTGAAATGTATTAGCGAGATTCATA TCTGAACCTCCGTCTATCGGTGTGATAATTAGCTACGTCGTTGACTTGGTTCGGACTCGCTTCTAACCGTCCGCG AGGACAAACATACTTGACAATTGACCT

 

> 156007_ Ravi

ATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTTGGGAGCATGTGCACGCCTTGTCATCTTTATATCT CCACCTGTGCACCTTTTGTAGACCTTTCAGGTCTATGTTGCTTCATTTACCCCAATGTATGTTAATAGAATGTTG TGCCTTATATAATAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATG CGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCG AGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCCTTCACTTGTTGAGCGGTTTGGATGTGGGGGTTTGCC TGGCCTCTTAAAAGGTTTTGGCTCCCCTGAAATGCATTAGCAGAACAACCCTGTTCATTGGTGTGATAAACTATC TACGCTATTGAATGTGAAGGGCAGTTTGGCTTTCTAACAGTCCTCGGACAAACTCATCATTAATG

 

> 156035 _ Nalanie

CATTATTGAATAAACCTGATGGGTTGTAGCTGGTTCCTCCTGGGACAAGTGCTCGCCTGTCATCTTTATATCTCC ACCTGTGCACTTTTTGTAGACCTGGATAACTTTCTGAGGCAACTCAGTTCGGAGGACTGCTGTGTGTTTTNCTAC GCCGGCTTTCCTTACATTTCCAGGCCTANGTTTTTCATATACCCCATTGTATGTAACAGAATGTTTCACAAGGCT TCAATGCCTATAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAA TGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTC CGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTATCAGCTTTTCACAAAGCTTGGTAAGGCTTGGAT GTGGAGGTTTGCAGGCTTCTTACAAAGTCAGCTCCTCTGAAATGCATTAGCGGTACCCGTGTGGAATCGTCTATT GGTGTGATAATATCTACGCCGTGGACATCTGCTTTAAATGGGTTATGCTGCTTATAACCGTCCCACTGTGGACAA CTTATGACAATTTGACCT

 

> 157005_ Yana

CATTATTGAAATAAACCTGCTGGGTTGTTGCTGGCTCTCTAGGGAGCATGTGCACGCCTTGTCATCTTTATATCT CCACCTGTGCACCTTTTGTAGACATCTTTCCCAGGTGTCTATGTTGACCCTTCATTTGCCCCCAATGTATGTCAA TAGAATGTTGTGTCCATGATAATAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGC TCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATTATATATCGAACCCTCTTTTGTTGAGTGGT TTGGATGTGGGGTTTGCTGGCCTCTTGAAGAGGTCAGCTTCCCTGAAATGCATTAGCAGAACAACCTGTTCGTTC ATTGGTGTGATAACTATCTACGCTATTGAATGGTGAAGGCAATTTCAGCTTCCTAACCGTCTTTGGACAATTTAT CAATCTATATGTGACCT

 

> 156005 _ Jonathan

CATTATTGAAATAACCTGATGGGTTGTTGCTGGTTCTCTTGGGAGCATGTGCACGCCTTGTCATCTTTATATCTC CACCTGTGCACCTTTTGTAGACCTTTCAGGTCTATGTTGCTTCATTTACCCCAATGTATGTTAATAGAATGTTGT GCCTTATATAATAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGC GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGA GGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCCTTCACTTGTTGAGCGGTTTGGATGTGGGGGTTTGCCT GGCCTCTTAAAAGGTTTTGGCTCCCCTGAAATGCATTAGCAGAACAACCCTGTTCATTGGTGTGATAAACTATCT ACGCTATTGAATGTGAAGGGCAGTTTGGCTTTCTAACAGTCCTCGGACAAACTCATCATTAATGTGACCT

 

> 156907 _ Ionatan

CATTATTGAAATAAACCTGATGAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCGTCTTTATATTTC CACCTTGTGCACCTTTTGTAGACCTGGATATCTCTCTGAATGCACACAAGCATTTGGGTTTGAGGGGTTGACTTT TTTGGTCTCCCTTTATATTTCCAGGCCTATGTTTCTTTCATATACCCCACTTGTGTTATAGAATGTAATAAATGG GCCTTTGTGCCTGTAAAGCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGA AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT TCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAACTTGTGTTGAGTGTTGGATGTGGGGG TTCTTTCTTTGCTGGCTTCACGGTCAGCTCCCCTGAAATGCATTAGCGGAACAACCTGTTCACTGTTCATTGGCG TGATAACTATCTACGCTGCTTGTTGACAGTGAAGCAAGTTCAGCTTCTAACAGTCCATTAAATTGGACAAATTTTTATTAATGTGACCT

 

> 157049 _ Julia

CATTATTGAATGAACTTGGTGTGGTTGTTGCTGGCTCTTTCGAGGGCATGTGCACGCCCACCATCCTCATCTCTC CACCTGTGCACCTCTTGTAGACTTGGATTGACTTTCCGAGGCAACTCGGTCGGGAGGATTGCCGGCGCCAGCTGG CTTTCTTTGCATTTCCAGGTCTACGTTTTTCATATACCCCATTGTATGTAACAGAATGTAACATTGGGCACTTGT GCCTATAAACTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGA TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGG AGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTATCAACTTTTGTTGATAATGGCTTGGATATGGGGGTT TATTTTGCTGGCTTCTTTACAGATGGTCAGCTCCCCTTAAATGCATTAGCCGGTGCCCCGCGTGGACTGTCTATT GGTGTGATAATTATCTACGCCGTGGACATCTGCAATCATATGGGTTTGCACTGCTTCCAACTGTCTGTTGAATCA GACAATACATGACAATTTGACCT

 

> 156019_ Joe

CATTAACGAATTTCTCAAAGTTGCTTACAGCGTTGTGCGGTCATTCGCATATGTTGAAGGTAGCTCTTGAGCATT TCACACATCCCCTGTGCACCTTAAGAGGGTAACTGTTTTATCTTGAGCGCGTTGTGCTCGATAGGACGTGTTGCC CTCTCTTTACAAAATCTTATGTCTAGAATGTCTGATAAAATTAAACAAAATAACTTTCAACAACGGATCTCTTGG CTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGATAATCTCAAATCAACAT TTTAGTTAATCTAATTTGTTGACTTGGACTTGGAGGTTGTGCTGATTTTATTATTGGCTCCTCTTAAATGCATTA GCTGGATTACTATCAGTAATAGTCCATGGTGTTGTAATCTCGGCGCTGTGACTTAACTAATACAATCTGCTTCTA AAATAGTTGCCTTTGGCAATATTTGCAAACTTGACCT

 

 

> 156874 _res1

CATTATCGTACAAAATGTGTGAWGGCGCGTGAGGGCTGTCGCTGACTTTTTAACACAAAAGTCGTGCACCGGA GCGCGTCCTCTCGCATAAAATCCATCTCACCCTTTTGTGCACCACCGCGTGGGCACCCTTTGGGATCGAACCGAT CCAGGAGGGTGCTTGCGTTTTCACACAAACCCCCTTTAAAAAGTGTAGAATGTCCCCATTTTGCGATGACACGCA ATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATG TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCC GTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTCTCCTTCTGGACACCGAAGGAGGCTTGGACTCTGGAGGCCT TTGCTGGCGTCTCTCTCTTTTTGAGAGCCAGCTCCTCTTAAACGAATTAGCGGGGTCCTCTTTGCCGATCCTCGA CATGTGATAAGATGTTTCCGTGTCTTGGTTTCTGGCTCTGTTGCCTTTGGGACCCGCTTCTAACCGTCTCAACGA GACGACGTTTGGGCGTGTCTCCCTTCTCGGGAAACTCTCTCAACCCCACGAACCCTTGACCT

 

> 155844_res2

CATTATTGAATAACTTGGTGTTGAGCTGGCCCTATTGGGCATGTGCTCGCATCATATTATTTATCTATCTCTTGT GCACCTTTTGTAGTCTTTGGAGCACTCGCAGTCAATGCGGTTTTGGGGCTTGGGCTTTGCTGCCCTTTTCCCTGT TTGCTTCAAAGGCTATGTTTTATACACACTATTGAAGTTACAGAATGTCTCTTATTGACTTTGAGTCAGTAAATC TATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTT TGAGTGTCATTAAATTCTCAACCTTGCAAGCTTGCTTGCGAGGCTTGGATGTGAGGGTTTTTGCTGGCTTCCTTT AGTTGGATGGTCTGCTCCCTTTAAATTCATTAGTGGGATCCTTTGTGGATGGTCACTTGGTGTGATAATTATCTA CGCCGTCTGATCCTGAAACAAGACTTGTGGGGACCTGCTTATAACCGTCTCTTTGGAGACAATCTTGACAATTTGACCT